16S and 18S ribosomal RNA (rRNA) sequencing are common amplicon sequencing methods used to identify and compare bacteria or fungi present within a given sample. 16S and 18S sequencing are well-established methods for comparing sample phylogeny and taxonomy from complex microbiomes or environments that are difficult or impossible to study.
The TGC offers a flexible PCR amplicon sequencing workflow. We prepare 16S (V3 and V4 regions) and 18S sequencing libraries from genomic DNA and amplicon libraries from user-provided PCR amplicons.
For user-prepared PCR amplicons, the PCR primers must contain the following over-hang sequences:
Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus‐specific sequence]
Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus‐specific sequence]
For orders please read the samples delivery instructions, fill and send us the electronic sample sheet.
For additional information, please contact:
Liat Linde, tel 077-8875452/168
Rappaport building 077-8875221
Emerson building 077-8871387
