Sanger

Sanger sequencing, the most widely used DNA sequencing method for the last 25 years or so, is based on the selective incorporation of chain-terminating dideoxynucleotides. The center offers Sanger for long contiguous DNA sequences (~900 nucleotides). We perform QC for all reactions before uploading the results.

Available Primers for Plasmids: 

Available Primers for Plasmids: 
Primer nameSequence
T7TAATACGACTCACTATAGGG
T7-shortAATACGACTCACTATAG
T7-TerGCTAGTTATTGCTCAGCGG
T3ATTAACCCTCACTAAAGGGA
SP6TATTTAGGTGACACTATAG
(-20) M13 FTGTAAAACGACGGCCAGT
(-20) M13 RAACAGCTATGACCATGATTA
(-40) M13 FGTTTTCCCAGTGACGCA
PGL FCTAGCAAAATAGGCTGTCCC
PGL RGAAATACAAAAACCGCAGAAGG
CMV PROATTGACGCAAATGGGCGGTA
PGEX3 RCCGGGAGCTGCATGTGTCAGAGG

 

For data analysis we recommend to download the Chromas software for free. Import the ab1 files and view the electropherogram.

For sample and primer specification please read the instructions.

For new orders please go to BookitLab and follow the 'create new order' instructions.

For additional information, please contact:

 Liat Linde, tel 077-8875452/168

Rappaport building 077-8875221

Emerson building 077-8871387

 

Sanger sequencing